Guidance and Counselling and Learners’ Discipline in Kasese District: A Case of Selected Government-Aided Secondary Schools in Bukonzo County. by Kule, Samson

“…Thoresen (1969) hypothesized that all behaviours, whether adaptive or maladaptive are learnt, shaped or maintained through stimulus responses. 2. …”
Get full text

Guidance and Counselling and Learners’ Discipline in Kasese District: A Case of Selected Government-Aided Secondary Schools in Bukonzo County. by Kule, Samson

“…Thoresen (1969) hypothesized that all behaviours, whether adaptive or maladaptive are learnt, shaped or maintained through stimulus responses. 2. …”
Get full text

Information Communication Technology and Service Delivery in Nyagatare District Local Goverment, Rwanda. by Wellars, Kanamugire

“…Among the role ICT had played in improving service delivery in the study area included quick service delivery and quick retrieval of information whether it was needed for use. However, the study findings concluded that the majority of respondents (90%) noted that there were challenges that hindered the implementation of ICT and service delivery in the study area. …”
Get full text

Automatic Recognition of Authors Identity in Persian based on Systemic Functional Grammar by Fatemeh Soltanzadeh, Azadeh Mirzaei, Mohammad Bahrani, Shahram Modarres Khiabani

“…., 2007). Comments can target either the ideational content of the proposition or the interpersonal aspects of the speech function (Halliday & Matthiessen, 2014). …”
Get full text

Noninferiority trial in veal calves on the efficacy of oxytetracycline and florfenicol treatment for pneumonia guided by quick thoracic ultrasound by Stan Jourquin, Florian Debruyne, Laurens Chantillon, Thomas Lowie, Randy Boone, Jade Bokma, Bart Pardon

“…Overall, final cure of all calves with either moderate or severe pneumonia during the trial was 41.2% (52/102) and 19.0% (12/63), respectively. …”
Get full text

The Effects on Knee Swelling, Range of Motion and Pain using a Commercially Available Hot/Cold Contrast Device in a Rehabilitation and Sports Medicine Setting by Kevin E Wilk, Robert E Mangine, James Tersakjs, Kimberly Hasselford

“…Typically, the intervention is performed by either the use of a hot and cold whirlpool or by applying hot and cold packs which can be very time consuming and labor intensive. …”
Get full text

Usefulness of a personalized algorithm‐based discharge checklist in patients hospitalized for acute heart failure by Florent Allain, Virginie Loizeau, Laure Chaufourier, Maya Hallouche, Laurence Herrou, Amir Hodzic, Katrien Blanchart, Annette Belin, Alain Manrique, Paul Milliez, Rémi Sabatier, Damien Legallois

“…Subgroup analysis including only patients with either altered (<40%) or mid‐range or preserved (≥40%) LVEF showed no significant difference among groups. …”
Get full text

Effects of Jianpi therapy for cancer-related fatigue:a meta-analysis of randomized controlled trials by Jiaxing Dai, Jiaxing Dai, Huili Shui, Huili Shui, Huili Shui, Yuan Wu, Huanghui Zhang, Huanghui Zhang, Yuanyin Li, Yuanyin Li, Shaowang Zhang, Shaowang Zhang, Bing Yang, Bing Yang, Bing Yang, Dongxin Tang, Dongxin Tang, Dongxin Tang

“…The extracted data were subjected to analysis using Stata (Version 15.1), with the selection of either a random-effects or fixed-effects model based on the heterogeneity among studies. …”
Get full text

The effect of transcutaneous auricular vagus nerve stimulation on cardiovascular function in subarachnoid hemorrhage patients: A randomized trial by Gansheng Tan, Anna L Huguenard, Kara M Donovan, Phillip Demarest, Xiaoxuan Liu, Ziwei Li, Markus Adamek, Kory Lavine, Ananthv K Vellimana, Terrance T Kummer, Joshua W Osbun, Gregory J Zipfel, Peter Brunner, Eric C Leuthardt

“…Methods: In this randomized clinical trial, 24 SAH patients were assigned to either a taVNS treatment or a sham treatment group. …”
Get full text

On liability for stalking in the context of the Istanbul convention implementation by Dudorov O., Dudorova K.

“…It has been proven that the article on persecution can be placed either in Chapter III of the Special Part of the Criminal Code of Ukraine (given that personal freedom as the generic object of the relevant criminal offenses, not limited to the physical freedom of a person, includes the freedom of a person in terms of the possibility of choice behavior, the freedom to manage oneself independently and is consistent with the civilized understanding of personal freedom as personal non-proprietor good of an individual), or in Chapter V of the Special Part of the Criminal Code of Ukraine – along with similar in their scope provisions, which are designed to ensure privacy protection and with the help of which separate manifestations of persecution can be considered today. …”
Get full text

Effectiveness of late and very late antivenom administration on recovery from snakebite-induced coagulopathy in French Guiana: a population-based studyResearch in context by Jean Marc Pujo, Stephanie Houcke, Guy Roger Lontsi Ngoulla, Vivian Laurent, Boubacar Signaté, Rémi Mutricy, Alexis Frémery, Flaubert Nkontcho, Ibtissem Ben Amara, José María Gutiérrez, Dabor Resiere, Hatem Kallel

“…We included all patients hospitalized for SB envenoming who either did not receive AV or received it more than 6 h after SB. …”
Get full text

Comparison of Percutaneous Transforaminal Endoscopic Surgery (PTES) With MIS-TLIF for Treating Lumbar Degenerative Disease in Obese Patients by Fan W, Chen Y, Zhou T, Xu Y, Gu Y

“…Wenshuai Fan,1,2,&ast; Yuheng Chen,1,&ast; Tianyao Zhou,1 Yun Xu,3,4 Yutong Gu1,4 1Department of Orthopaedic Surgery, Zhongshan Hospital Fudan University, Shanghai, People’s Republic of China; 2Department of Orthopaedics, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, People’s Republic of China; 3Centre for Rehabilitation Medicine, Department of Pain Management, Zhejiang Provincial People’s Hospital, Zhejiang, People’s Republic of China; 4Shanghai Southwest Spine Surgery Center, Shanghai, People’s Republic of China&ast;These authors contributed equally to this workCorrespondence: Yutong Gu, Zhongshan Hospital Fudan University, 180 Fenglin Road, Shanghai, 200032, People’s Republic of China, Email 447574313@qq.com Yun Xu, Zhejiang Provincial People’s Hospital, Hangzhou Medical College, Hangzhou, 310014, People’s Republic of China, Email xuyun65204@163.comPurpose: The purpose of this study is to compare clinical outcomes of obese patients with lumbar degenerative disease (LDD) receiving either percutaneous transforaminal endoscopic surgery (PTES) or minimally invasive surgery-transforaminal lumbar interbody fusion (MIS-TLIF).Methods: There were 26 patients underwent PTES, and 29 patients were treated with MIS-TLIF between June 2014 and June 2019. …”
Get full text

Dechlorination of selected polychlorinated biphenyl congeners using metal-impregnated pulverized shrimp shell catalyst from waste by D.B. Aviantara, F. Suciati, G. Hadiko, N.S. Indrasti, M. Yani

“…Such a low degree of effectiveness may be caused by the catalyst becoming inactive, either chemically through the deposition of chlorines that have been removed from the biphenyl ring or mechanically by the leaching of zinc from the surface of the pulverized shrimp shell due to insufficient mechanical strength. …”
Get full text

Knowledge Distillation in Object Detection for Resource-Constrained Edge Computing by Arief Setyanto, Theopilus Bayu Sasongko, Muhammad Ainul Fikri, Dhani Ariatmanto, I. Made Artha Agastya, Rakandhiya Daanii Rachmanto, Affan Ardana, In Kee Kim

“…We consider both accuracy drop and model size to choose either MobileNetV2 or RepViT model to replace CSPDarknet53 in the modified YOLOv4 named M-YOLO-CRD and RV-YOLO-CRD. …”
Get full text

Is Intra-articular Platelet-rich Plasma Injection Safe and Effective in Osteoarthritis Knee? A Prospective Study: A Case Series by R Sahaya Jose, N Kattu Bava, M Syed Moosa

“…In total, 30 patients of either sex, between 40 and 70 years of age, suffering from primary knee OA with Kellgren–Lawrence (KL) grades I, II, or III on standing anteroposterior and lateral knee radiographs, with symptoms for >3 months according to the American College of Rheumatology (ACR) clinical classification criteria and pain score of >4 cm on 10 cm visual analog scale (VAS) was included. …”
Get full text

Functional assessment of the glycoproteins of a novel Hendra virus variant reveals contrasting fusogenic capacities of the receptor-binding and fusion glycoproteins by Andrew Z. Ma, Yao Yu Yeo, Jean F. Lee, Colin M. Kim, Shahrzad Ezzatpour, Carolina Menchaca, Viraj Upadhye, Edward J. Annand, John-Sebastian Eden, Raina K. Plowright, Alison J. Peel, David W. Buchholz, Hector C. Aguilar

“…By using heterotypic combinations of HeV-g2 with either HeV-g1 or NiV glycoproteins, as well as chimeric HeV-g1/HeV-g2 glycoproteins, we demonstrate that the differences in syncytial formation can be attributed to the intrinsic fusogenic capacities of each glycoprotein. …”
Get full text

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

“…Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of &#x003E; 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). …”
Get full text

Time-dynamic associations between symptom-related expectations, self-management experiences and somatic symptom severity in everyday life: an ecological momentary assessment study... by Bernd Löwe, Yvonne Nestoriuc, Anne Toussaint, Stefanie Hahn, Franz Pauls, Simon Kirchhof

“…Multilevel mixed-effects linear regression analyses were conducted for data analysis.Setting Data was collected in real-time from university students via smartphones, with three predetermined assessments per day over seven consecutive days.Participants A total of 104 students (63.5% male, 0% diverse) who were 18 years or older, possessing sufficient German language skills and had access to an Android-powered smartphone were included.Interventions Participants were randomised to one of two different expectation framing groups, either receiving questionnaires for the expected impairment due to somatic symptoms (negative framing) or for the expected freedom from impairment due to somatic symptoms (positive framing).Primary outcome measures Somatic symptom severity was assessed using an adapted version of the Patient Health Questionnaire, with 11-point instead of 3-point Likert-scales. …”
Get full text

PreS1 deletions in genotype C HBV leads to severe hepatic inflammation and hepatocarcinogenesis via the IRE1-JNK axis by Yu-Min Choi, Junghwa Jang, Dong Hyun Kim, Ziyun Kim, Eunseo Kim, Won Hyeok Choe, Bum-Joon Kim

“…We found that the preS1Del variant selectively activates the IRE1 pathway, primarily through enhanced IRE1-JNK-IL6 signaling. Inhibition of either the IRE1-JNK pathway or IL6 reduced HBV replication and tumor load in in vivo HCC models. …”
Get full text

The use of Curcuma longa extract to control Edwardsiella tarda infection on Clarias sp. by Dinamella Wahjuningrum, Muharram Nur Ikhsan, , Sukenda, Yan Evan

“…Briefly, the objective was achieved through in vitro assay based on inhibition ability of extraction method against E. tarda, while the following objective was obtained through in vivo assay based on their survival during challenge test either as preventive or curative measurement. A complete randomized design with three replications was used for each assay. …”
Get full text