Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

“…Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). …”
Get full text

Polydomus karssenii gen. nov. sp. nov. is a dark septate endophyte with a bifunctional lifestyle parasitising eggs of plant parasitic cyst nematodes (Heterodera spp.) by Samad Ashrafi, Jan-Peer Wennrich, Yvonne Becker, Jose G. Maciá-Vicente, Anke Brißke-Rode, Matthias Daub, Torsten Thünen, Abdelfattah A. Dababat, Maria R. Finckh, Marc Stadler, Wolfgang Maier

“…Light microscopic observations on fungus-root interactions in an axenic system revealed the capacity of the same fungal strain to colonise the roots of wheat and produce melanised hyphae and microsclerotia-like structure typical for dark septate endophytes. Confocal laser scanning microscopy further demonstrated that the fungus colonised the root cells by predominant intercellular growth of hyphae, and frequent formation of appressorium-like as well as penetration peg-like structures through internal cell walls surrounded by callosic papilla-like structures. …”
Get full text

The Small Mobile Ozone Lidar (SMOL): instrument description and first results by F. Chouza, T. Leblanc, P. Wang, S. S. Brown, K. Zuraski, K. Zuraski, W. Chace, W. Chace, W. Chace, C. C. Womack, C. C. Womack, J. Peischl, J. Peischl, J. Hair, T. Shingler, J. Sullivan

“…The transmitter is based on a quadrupled Nd:YAG laser, which is further converted into a 289/299 nm wavelength pair using Raman shifting cells, and the receiver consists of three ozone DIAL pairs, including one that is 266/289 nm and two that are 289/299 nm. …”
Get full text

The effect of electroslag remelting on the cleanliness of CrNiMoWMnV ultrahigh-strength steels by Ali M., Porter D., Kömi J., Heikkinen E.P., Eissa M., El Faramawy H., Mattar T.

“…Cast ingots were forged at temperatures between 1100 and 950°C, air cooled, and their non-metallic inclusions (NMIs) were characterized using field emission scanning electron microscopy and laser scanning confocal microscopy. Thermodynamic calculations for the expected NMIs formed in the investigated steels with and without ESR were performed using FactSage 7.2 software while HSC Chemistry version 9.6.1 was used to calculate the standard Gibbs free energies (ΔG°). …”
Get full text

msiFlow: automated workflows for reproducible and scalable multimodal mass spectrometry imaging and microscopy data analysis by Philippa Spangenberg, Sebastian Bessler, Lars Widera, Jenny Bottek, Mathis Richter, Stephanie Thiebes, Devon Siemes, Sascha D. Krauß, Lukasz G. Migas, Siva Swapna Kasarla, Prasad Phapale, Jens Kleesiek, Dagmar Führer, Lars C. Moeller, Heike Heuer, Raf Van de Plas, Matthias Gunzer, Oliver Soehnlein, Jens Soltwisch, Olga Shevchuk, Klaus Dreisewerd, Daniel R. Engel

“…Abstract Multimodal imaging by matrix-assisted laser desorption ionisation mass spectrometry imaging (MALDI MSI) and microscopy holds potential for understanding pathological mechanisms by mapping molecular signatures from the tissue microenvironment to specific cell populations. …”
Get full text

Multimessenger Probes of Supermassive Black Hole Spin Evolution by Angelo Ricarte, Priyamvada Natarajan, Ramesh Narayan, Daniel C. M. Palumbo

“…We further predict spin distributions accessible via spatially resolved event horizons by the next-generation Event Horizon Telescope and Black Hole Explorer, as well as gravitational waves by the Laser Interferometer Space Antenna (LISA), each of which offers unique and distinct windows into the population of spinning BHs. …”
Get full text

A structural analysis of ordered Cs3Sb films grown on single crystal graphene and silicon carbide substrates by C. A. Pennington, M. Gaowei, E. M. Echeverria, K. Evans-Lutterodt, A. Galdi, T. Juffmann, S. Karkare, J. Maxson, S. J. van der Molen, P. Saha, J. Smedley, W. G. Stam, R. M. Tromp

“…In this report, we demonstrate the growth of ordered Cs3Sb films on single crystal substrates 3C-SiC and graphene-coated 4H-SiC using pulsed laser deposition and conventional thermal evaporation growth techniques. …”
Get full text

Functional outcomes in early (T1/T2) supraglottic cancer: a systematic review by Benjamin van der Woerd, Krupal B. Patel, Anthony C. Nichols, Kevin Fung, John Yoo, S. Danielle MacNeil

“…Studies were included if they reported functional outcomes on 10 or more patients with early stage SGC treated with radiation or OPS, including open partial laryngectomy, transoral laser microsurgery (TLM) or transoral robotic surgery (TORS). …”
Get full text

Benzo-pyrrolidinyl substituted silicon phthalocyanines: A novel two-photon lysosomal nanoprobe for in vitro photodynamic therapy by Xiuqin Chen, Guizhi Chen, Sitong Cao, Ruoxin Ye, Ruoyi Qiu, Xiangyu Yang, Yiru Peng, Hong Sun

“…These nanoparticles exhibit exceptional lysosome labeling capabilities, as evidenced by bioimaging techniques. Upon exposure to laser irradiation, DSPE@Py-SiPc efficiently induces the production of reactive oxygen species, impairing lysosomal function and triggering lysosomal-mediated cell death. …”
Get full text

Third-Order Nonlinear Optical Behavior of Novel Polythiophene Derivatives Functionalized with Disperse Red 19 Chromophore by Marilú Chávez-Castillo, Arelis Ledesma-Juárez, Marisol Güizado-Rodríguez, Jesús Castrellón-Uribe, Gabriel Ramos-Ortiz, Mario Rodríguez, José-Luis Maldonado, Jorge-Antonio Guerrero-Álvarez, Victor Barba

“…The third-order nonlinear optical response of these materials was performed with nanosecond and femtosecond laser pulses by using the third-harmonic generation (THG) and Z-scan techniques at infrared wavelengths of 1300 and 800 nm, respectively. …”
Get full text

Quantum machine learning with Adaptive Boson Sampling via post-selection by Francesco Hoch, Eugenio Caruccio, Giovanni Rodari, Tommaso Francalanci, Alessia Suprano, Taira Giordani, Gonzalo Carvacho, Nicolò Spagnolo, Seid Koudia, Massimiliano Proietti, Carlo Liorni, Filippo Cerocchi, Riccardo Albiero, Niki Di Giano, Marco Gardina, Francesco Ceccarelli, Giacomo Corrielli, Ulysse Chabaud, Roberto Osellame, Massimiliano Dispenza, Fabio Sciarrino

“…Here, we report the experimental implementation of quantum machine learning protocols by adding adaptivity via post-selection to a Boson Sampling platform based on universal programmable photonic circuits fabricated via femtosecond laser writing. Our experimental results demonstrate that Adaptive Boson Sampling is a viable route towards dimension-enhanced quantum machine learning with linear optical devices.…”
Get full text

Electroacupuncture Involved in Motor Cortex and Hypoglossal Neural Control to Improve Voluntary Swallowing of Poststroke Dysphagia Mice by Shuai Cui, Shuqi Yao, Chunxiao Wu, Lulu Yao, Peidong Huang, Yongjun Chen, Chunzhi Tang, Nenggui Xu

“…In the present work, we have investigated the effects of EA on the PSD mice in vivo and sought evidence for PSD improvement by electrophysiology recording and laser speckle contrast imaging (LSCI). Four main conclusions can be drawn from our study: (i) EA may enhance the local field potential in noninfarction area of M1, activate the swallowing-related neurons (pyramidal cells), and increase the motor conduction of noninfarction area in voluntary swallowing; (ii) EA may improve the blood flow in both M1 on the healthy side and deglutition muscles and relieve PSD symptoms; (iii) EA could increase the motor conduction velocity (MCV) in hypoglossal nerve, enhance the EMG of mylohyoid muscle, alleviate the paralysis of swallowing muscles, release the substance P, and restore the ability to drink water; and (iv) EA can boost the functional compensation of M1 in the noninfarction side, strengthen the excitatory of hypoglossal nerve, and be involved in the voluntary swallowing neural control to improve PSD. …”
Get full text

Review on the Millimeter-Wave Generation Techniques Based on Photon Assisted for the RoF Network System by Jiangnan Xiao, Chuang Zhao, Xingxing Feng, Xu Dong, Jiangli Zuo, Jun Ming, Ye Zhou

“…Then we, respectively, introduce the modulation schemes of RoF mm-wave generation based on photon assisted including directly modulated laser (DML), external modulation, and optical heterodyne. …”
Get full text

A New Nanocomposite for Inducing Demineralized Dentin Remineralization by Ban G, Long J, Yan K, Li Q, Huang X, Wei X, Xie F

“…The effects were observed using a laser scanning confocal fluorescence microscope (CLSM), scanning electron microscopy (SEM), and TEM.Results: The PAMAM-COOH/ACMP-MDP ethanol solution we prepared maintained stable physicochemical properties after two months of storage. …”
Get full text

Saliva-acquired pellicle inspired multifunctional gargle with wet adhesion, photodynamic antimicrobial, and In situ remineralization properties for dental caries prevention by Jiayi Shi, Xuekai Qi, Ying Ran, Qiang Zhou, Yiqin Ding, Lujian Li, Youyun Zeng, Dongchao Qiu, Zhibin Cai, Xiaojun Cai, Yihuai Pan

“…CP-SAP rapidly adhered to the dental surface and remained effective for extended periods. Upon laser irradiation, Ce6 generated reactive oxygen species (ROS), disrupting bacterial outer membrane integrity, causing protein leakage, and reducing ATP levels, thereby achieving potent antibacterial effects. …”
Get full text

Intravitreal Bevacizumab (Avastin) for Diabetic Retinopathy: The 2010 GLADAOF Lecture by J. Fernando Arevalo, Juan G. Sanchez, Andres F. Lasave, Lihteh Wu, Mauricio Maia, Sergio Bonafonte, Miguel Brito, Arturo A. Alezzandrini, Natalia Restrepo, Maria H. Berrocal, Mario Saravia, Michel Eid Farah, Jans Fromow-Guerra, Virgilio Morales-Canton

“…Therefore, in the future this new therapy could complement focal/grid laser photocoagulation in DME. In PDR, this new option could be an adjuvant agent to panretina photocoagulation so that more selective therapy may be applied. …”
Get full text

Kinetics, thermodynamics, and catalysis of the cation incorporation into GeO2, SnO2, and (SnxGe1−x)O2 during suboxide molecular beam epitaxy by Wenshan Chen, Kingsley Egbo, Joe Kler, Andreas Falkenstein, Jonas Lähnemann, Oliver Bierwagen

“…The results are likely transferable to further physical and chemical vapor deposition methods, such as conventional and hybrid MBE, pulsed laser deposition, mist-, or metalorganic chemical vapor deposition.…”
Get full text

Micro-Electro Nanofibrous Dressings Based on PVDF-AgNPs as Wound Healing Materials to Promote Healing in Active Areas by Liu T, Xie F, Geng L, He R, Sun M, Ni T, Xu P, Xing C, Peng Y, Chen K, Fang Y

“…Tiantian Liu,1,2,* Feifei Xie,3,4,* Lele Geng,1,2 Ruizhe He,1,2 Mengzhe Sun,1,2 Tao Ni,1,2 Peng Xu,1,2 Chao Xing,1,2 Yinbo Peng,1,2 Ke Chen,3,4 Yong Fang1,2 1Department of Burns and Plastic Surgery, Shanghai Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, People’s Republic of China; 2Institute of Traumatic Medicine, Shanghai Jiao Tong University School of Medicine, Shanghai, People’s Republic of China; 3School of Materials Science and Engineering, Shanghai Jiao Tong University, Shanghai, People’s Republic of China; 4Shanghai Key Laboratory of Materials Laser Processing and Modification, Shanghai Jiao Tong University, Shanghai, People’s Republic of China*These authors contributed equally to this workCorrespondence: Yong Fang, Department of Burns and Plastic Surgery, Shanghai Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, People’s Republic of China, Email fangyong1020@hotmail.com Ke Chen, School of Materials Science and Engineering, Shanghai Jiao Tong University, Shanghai, People’s Republic of China, Email chenke83@sjtu.edu.cnPurpose: The purpose of this study is to develop an innovative solution for chronic wounds in high-mobility areas, such as joints, where conventional treatments are hindered by passive healing mechanisms and the need for immobilization. …”
Get full text

Molecular Epidemiological Characteristics of <i>Staphylococcus pseudintermedius</i>, <i>Staphylococcus coagulans,</i> and Coagulase-Negative Staphylococci Cultured from Clinical Ca... by Sara Horsman, Julian Zaugg, Erika Meler, Deirdre Mikkelsen, Ricardo J. Soares Magalhães, Justine S. Gibson

“…These isolates underwent matrix-assisted laser desorption ionisation– time of flight bacterial identification, minimum inhibitory concentration testing using Sensititre^TM plates and WGS. …”
Get full text

Antibiofilm activity of 3,3'-diindolylmethane on Staphylococcus aureus and its disinfection on common food-contact surfaces by Hui Zhang, Xiaomei Guo, Lei Tian, Na Wang, Yuqing Li, Ariel Kushmaro, Robert Marks, Qun Sun

“…DIM in the concentration range of 31.2−62.5 μmol/L demonstrated a dose-dependent antibiofilm activity to S. aureus, as confirmed by light microscopic (LM), confocal laser scanning microscopic (CLSM), and scanning electron microscopic (SEM) analyses. …”
Get full text