A Case Report of Clinical Characteristics of Deficiency of Adenosine Deaminase 2 with Pancytopenia
Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed...
Saved in:
| Main Authors: | , , , , , |
|---|---|
| Format: | Article |
| Language: | zho |
| Published: |
Editorial Office of Journal of Rare Diseases
2024-10-01
|
| Series: | 罕见病研究 |
| Subjects: | |
| Online Access: | https://jrd.chard.org.cn/article/doi/10.12376/j.issn.2097-0501.2024.04.013 |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
| _version_ | 1841555718806700032 |
|---|---|
| author | ZHANG Caihui LIU Liying ZHANG Zhenjie WANG Wei MA Mingsheng SONG Hongmei |
| author_facet | ZHANG Caihui LIU Liying ZHANG Zhenjie WANG Wei MA Mingsheng SONG Hongmei |
| author_sort | ZHANG Caihui |
| collection | DOAJ |
| description | Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation. |
| format | Article |
| id | doaj-art-f6277193a202406a8eb8f75b3cfdc460 |
| institution | Kabale University |
| issn | 2097-0501 |
| language | zho |
| publishDate | 2024-10-01 |
| publisher | Editorial Office of Journal of Rare Diseases |
| record_format | Article |
| series | 罕见病研究 |
| spelling | doaj-art-f6277193a202406a8eb8f75b3cfdc4602025-01-08T05:21:43ZzhoEditorial Office of Journal of Rare Diseases罕见病研究2097-05012024-10-013450150610.12376/j.issn.2097-0501.2024.04.013A Case Report of Clinical Characteristics of Deficiency of Adenosine Deaminase 2 with PancytopeniaZHANG CaihuiLIU LiyingZHANG Zhenjie0WANG Wei1MA Mingsheng2SONG Hongmei3Department of Pediatrics, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100730, ChinaDepartment of Pediatrics, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100730, ChinaDepartment of Pediatrics, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100730, ChinaDepartment of Pediatrics, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100730, ChinaDeficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.https://jrd.chard.org.cn/article/doi/10.12376/j.issn.2097-0501.2024.04.013deficiency of adenosine deaminase 2childrenhematologic systemgenetic test |
| spellingShingle | ZHANG Caihui LIU Liying ZHANG Zhenjie WANG Wei MA Mingsheng SONG Hongmei A Case Report of Clinical Characteristics of Deficiency of Adenosine Deaminase 2 with Pancytopenia 罕见病研究 deficiency of adenosine deaminase 2 children hematologic system genetic test |
| title | A Case Report of Clinical Characteristics of Deficiency of Adenosine Deaminase 2 with Pancytopenia |
| title_full | A Case Report of Clinical Characteristics of Deficiency of Adenosine Deaminase 2 with Pancytopenia |
| title_fullStr | A Case Report of Clinical Characteristics of Deficiency of Adenosine Deaminase 2 with Pancytopenia |
| title_full_unstemmed | A Case Report of Clinical Characteristics of Deficiency of Adenosine Deaminase 2 with Pancytopenia |
| title_short | A Case Report of Clinical Characteristics of Deficiency of Adenosine Deaminase 2 with Pancytopenia |
| title_sort | case report of clinical characteristics of deficiency of adenosine deaminase 2 with pancytopenia |
| topic | deficiency of adenosine deaminase 2 children hematologic system genetic test |
| url | https://jrd.chard.org.cn/article/doi/10.12376/j.issn.2097-0501.2024.04.013 |
| work_keys_str_mv | AT zhangcaihui acasereportofclinicalcharacteristicsofdeficiencyofadenosinedeaminase2withpancytopenia AT liuliying acasereportofclinicalcharacteristicsofdeficiencyofadenosinedeaminase2withpancytopenia AT zhangzhenjie acasereportofclinicalcharacteristicsofdeficiencyofadenosinedeaminase2withpancytopenia AT wangwei acasereportofclinicalcharacteristicsofdeficiencyofadenosinedeaminase2withpancytopenia AT mamingsheng acasereportofclinicalcharacteristicsofdeficiencyofadenosinedeaminase2withpancytopenia AT songhongmei acasereportofclinicalcharacteristicsofdeficiencyofadenosinedeaminase2withpancytopenia AT zhangcaihui casereportofclinicalcharacteristicsofdeficiencyofadenosinedeaminase2withpancytopenia AT liuliying casereportofclinicalcharacteristicsofdeficiencyofadenosinedeaminase2withpancytopenia AT zhangzhenjie casereportofclinicalcharacteristicsofdeficiencyofadenosinedeaminase2withpancytopenia AT wangwei casereportofclinicalcharacteristicsofdeficiencyofadenosinedeaminase2withpancytopenia AT mamingsheng casereportofclinicalcharacteristicsofdeficiencyofadenosinedeaminase2withpancytopenia AT songhongmei casereportofclinicalcharacteristicsofdeficiencyofadenosinedeaminase2withpancytopenia |