Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan

In the tomato commercial growing districts of Khyber Pakhtunkhwa (KP); a province in the north west of Pakistan, multiple comprehensive surveys were conducted during 2012. The main objectives of the current study were to identify the Ralstonia solanacearum (R. solanacearum) isolate through its col...

Full description

Saved in:
Bibliographic Details
Main Authors: Muhammad Junaid, Ayesha Bibi, Musharaf Ahmad, Muhammad Ali, Yousaf Noor
Format: Article
Language:English
Published: ResearchersLinks, Ltd 2019-04-01
Series:Novel Research in Microbiology Journal
Subjects:
Online Access:https://nrmj.journals.ekb.eg/article_30611_d55a38a5349b8d0fa9d9dea0e9faa5fa.pdf
Tags: Add Tag
No Tags, Be the first to tag this record!
_version_ 1849763835775287296
author Muhammad Junaid
Ayesha Bibi
Musharaf Ahmad
Muhammad Ali
Yousaf Noor
author_facet Muhammad Junaid
Ayesha Bibi
Musharaf Ahmad
Muhammad Ali
Yousaf Noor
author_sort Muhammad Junaid
collection DOAJ
description In the tomato commercial growing districts of Khyber Pakhtunkhwa (KP); a province in the north west of Pakistan, multiple comprehensive surveys were conducted during 2012. The main objectives of the current study were to identify the Ralstonia solanacearum (R. solanacearum) isolate through its colony characteristics, molecular tools; and to investigate the ability of this pathogen to cause Bacterial wilt (BW) disease, when being inoculated into tomato plant using different inoculation methods. For this purpose, a total of 74 locations covering all over the KP were visited for the presence of tomato plants with BW disease, caused by R. solanacearum. The bacterial pathogen was isolated from diseased plant tissues by growing it on the selective 2,3,5-triphenyltetrazolium chloride (TTC) medium. Based on colony morphology of R. solanacearum on the agar plates; and pathogenicity assays, about 29 isolates were guessed to be R. solanacearum. To further confirm the identity of these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty five isolates out of the 29 were genetically confirmed to be R. solanacearum based on their amplified 281bp band.
format Article
id doaj-art-c05067dd4bf44f2b98c5681898f95f87
institution DOAJ
issn 2537-0286
2537-0294
language English
publishDate 2019-04-01
publisher ResearchersLinks, Ltd
record_format Article
series Novel Research in Microbiology Journal
spelling doaj-art-c05067dd4bf44f2b98c5681898f95f872025-08-20T03:05:17ZengResearchersLinks, LtdNovel Research in Microbiology Journal2537-02862537-02942019-04-013231432510.21608/nrmj.2019.30611Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of PakistanMuhammad Junaid0Ayesha Bibi1Musharaf Ahmad2Muhammad Ali3Yousaf Noor4MFSC, Peshawar, Department of Agriculture Ext., Govt. of Khyber Pakhtunkhwah, PakistanDepartment of Soil Microbiology, DSPN, ARI Peshawar, Govt. of Khyber Pakhtu nkhwah, PakistanDepartment of Plant Pathology, The University of Agriculture, Peshawar, PakistanDepartment of Soil Microbiology, DSPN, ARI Peshawar, Govt. of Khyber Pakhtunkhwah, PakistanCereal Crop Research Institute, Pirsabak, Nowshera, Govt. of Khyber Pakhtunkhwah, PakistanIn the tomato commercial growing districts of Khyber Pakhtunkhwa (KP); a province in the north west of Pakistan, multiple comprehensive surveys were conducted during 2012. The main objectives of the current study were to identify the Ralstonia solanacearum (R. solanacearum) isolate through its colony characteristics, molecular tools; and to investigate the ability of this pathogen to cause Bacterial wilt (BW) disease, when being inoculated into tomato plant using different inoculation methods. For this purpose, a total of 74 locations covering all over the KP were visited for the presence of tomato plants with BW disease, caused by R. solanacearum. The bacterial pathogen was isolated from diseased plant tissues by growing it on the selective 2,3,5-triphenyltetrazolium chloride (TTC) medium. Based on colony morphology of R. solanacearum on the agar plates; and pathogenicity assays, about 29 isolates were guessed to be R. solanacearum. To further confirm the identity of these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty five isolates out of the 29 were genetically confirmed to be R. solanacearum based on their amplified 281bp band.https://nrmj.journals.ekb.eg/article_30611_d55a38a5349b8d0fa9d9dea0e9faa5fa.pdftomatobacterial wiltralstonia solanacearumpathogenicitypcr
spellingShingle Muhammad Junaid
Ayesha Bibi
Musharaf Ahmad
Muhammad Ali
Yousaf Noor
Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan
Novel Research in Microbiology Journal
tomato
bacterial wilt
ralstonia solanacearum
pathogenicity
pcr
title Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan
title_full Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan
title_fullStr Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan
title_full_unstemmed Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan
title_short Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan
title_sort molecular identification and pathogenicity of ralstonia solanacearum isolates collected from north west of pakistan
topic tomato
bacterial wilt
ralstonia solanacearum
pathogenicity
pcr
url https://nrmj.journals.ekb.eg/article_30611_d55a38a5349b8d0fa9d9dea0e9faa5fa.pdf
work_keys_str_mv AT muhammadjunaid molecularidentificationandpathogenicityofralstoniasolanacearumisolatescollectedfromnorthwestofpakistan
AT ayeshabibi molecularidentificationandpathogenicityofralstoniasolanacearumisolatescollectedfromnorthwestofpakistan
AT musharafahmad molecularidentificationandpathogenicityofralstoniasolanacearumisolatescollectedfromnorthwestofpakistan
AT muhammadali molecularidentificationandpathogenicityofralstoniasolanacearumisolatescollectedfromnorthwestofpakistan
AT yousafnoor molecularidentificationandpathogenicityofralstoniasolanacearumisolatescollectedfromnorthwestofpakistan