Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan
In the tomato commercial growing districts of Khyber Pakhtunkhwa (KP); a province in the north west of Pakistan, multiple comprehensive surveys were conducted during 2012. The main objectives of the current study were to identify the Ralstonia solanacearum (R. solanacearum) isolate through its col...
Saved in:
| Main Authors: | , , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
ResearchersLinks, Ltd
2019-04-01
|
| Series: | Novel Research in Microbiology Journal |
| Subjects: | |
| Online Access: | https://nrmj.journals.ekb.eg/article_30611_d55a38a5349b8d0fa9d9dea0e9faa5fa.pdf |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
| _version_ | 1849763835775287296 |
|---|---|
| author | Muhammad Junaid Ayesha Bibi Musharaf Ahmad Muhammad Ali Yousaf Noor |
| author_facet | Muhammad Junaid Ayesha Bibi Musharaf Ahmad Muhammad Ali Yousaf Noor |
| author_sort | Muhammad Junaid |
| collection | DOAJ |
| description | In the tomato commercial growing districts of Khyber Pakhtunkhwa (KP); a province in the north west of
Pakistan, multiple comprehensive surveys were conducted during 2012. The main objectives of the current study
were to identify the Ralstonia solanacearum (R. solanacearum) isolate through its colony characteristics,
molecular tools; and to investigate the ability of this pathogen to cause Bacterial wilt (BW) disease, when being
inoculated into tomato plant using different inoculation methods. For this purpose, a total of 74 locations covering
all over the KP were visited for the presence of tomato plants with BW disease, caused by R. solanacearum. The
bacterial pathogen was isolated from diseased plant tissues by growing it on the selective 2,3,5-triphenyltetrazolium chloride (TTC) medium. Based on colony morphology of R. solanacearum on the agar plates; and
pathogenicity assays, about 29 isolates were guessed to be R. solanacearum. To further confirm the identity of
these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific
primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer:
5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty five isolates
out of the 29 were genetically confirmed to be R. solanacearum based on their amplified 281bp band. |
| format | Article |
| id | doaj-art-c05067dd4bf44f2b98c5681898f95f87 |
| institution | DOAJ |
| issn | 2537-0286 2537-0294 |
| language | English |
| publishDate | 2019-04-01 |
| publisher | ResearchersLinks, Ltd |
| record_format | Article |
| series | Novel Research in Microbiology Journal |
| spelling | doaj-art-c05067dd4bf44f2b98c5681898f95f872025-08-20T03:05:17ZengResearchersLinks, LtdNovel Research in Microbiology Journal2537-02862537-02942019-04-013231432510.21608/nrmj.2019.30611Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of PakistanMuhammad Junaid0Ayesha Bibi1Musharaf Ahmad2Muhammad Ali3Yousaf Noor4MFSC, Peshawar, Department of Agriculture Ext., Govt. of Khyber Pakhtunkhwah, PakistanDepartment of Soil Microbiology, DSPN, ARI Peshawar, Govt. of Khyber Pakhtu nkhwah, PakistanDepartment of Plant Pathology, The University of Agriculture, Peshawar, PakistanDepartment of Soil Microbiology, DSPN, ARI Peshawar, Govt. of Khyber Pakhtunkhwah, PakistanCereal Crop Research Institute, Pirsabak, Nowshera, Govt. of Khyber Pakhtunkhwah, PakistanIn the tomato commercial growing districts of Khyber Pakhtunkhwa (KP); a province in the north west of Pakistan, multiple comprehensive surveys were conducted during 2012. The main objectives of the current study were to identify the Ralstonia solanacearum (R. solanacearum) isolate through its colony characteristics, molecular tools; and to investigate the ability of this pathogen to cause Bacterial wilt (BW) disease, when being inoculated into tomato plant using different inoculation methods. For this purpose, a total of 74 locations covering all over the KP were visited for the presence of tomato plants with BW disease, caused by R. solanacearum. The bacterial pathogen was isolated from diseased plant tissues by growing it on the selective 2,3,5-triphenyltetrazolium chloride (TTC) medium. Based on colony morphology of R. solanacearum on the agar plates; and pathogenicity assays, about 29 isolates were guessed to be R. solanacearum. To further confirm the identity of these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty five isolates out of the 29 were genetically confirmed to be R. solanacearum based on their amplified 281bp band.https://nrmj.journals.ekb.eg/article_30611_d55a38a5349b8d0fa9d9dea0e9faa5fa.pdftomatobacterial wiltralstonia solanacearumpathogenicitypcr |
| spellingShingle | Muhammad Junaid Ayesha Bibi Musharaf Ahmad Muhammad Ali Yousaf Noor Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan Novel Research in Microbiology Journal tomato bacterial wilt ralstonia solanacearum pathogenicity pcr |
| title | Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan |
| title_full | Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan |
| title_fullStr | Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan |
| title_full_unstemmed | Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan |
| title_short | Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan |
| title_sort | molecular identification and pathogenicity of ralstonia solanacearum isolates collected from north west of pakistan |
| topic | tomato bacterial wilt ralstonia solanacearum pathogenicity pcr |
| url | https://nrmj.journals.ekb.eg/article_30611_d55a38a5349b8d0fa9d9dea0e9faa5fa.pdf |
| work_keys_str_mv | AT muhammadjunaid molecularidentificationandpathogenicityofralstoniasolanacearumisolatescollectedfromnorthwestofpakistan AT ayeshabibi molecularidentificationandpathogenicityofralstoniasolanacearumisolatescollectedfromnorthwestofpakistan AT musharafahmad molecularidentificationandpathogenicityofralstoniasolanacearumisolatescollectedfromnorthwestofpakistan AT muhammadali molecularidentificationandpathogenicityofralstoniasolanacearumisolatescollectedfromnorthwestofpakistan AT yousafnoor molecularidentificationandpathogenicityofralstoniasolanacearumisolatescollectedfromnorthwestofpakistan |