Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2
Oculocutaneous albinism (OCA) is a condition inherited in an autosomal recessive manner, leading to reduced pigmentation in the skin, hair, and eyes. Oculocutaneous albinism type 2 (OCA2) is one of the most common forms of OCA, caused by OCA2 mutations. This case report presents a newborn with suspe...
Saved in:
| Main Authors: | , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
Frontiers Media S.A.
2025-04-01
|
| Series: | Frontiers in Pediatrics |
| Subjects: | |
| Online Access: | https://www.frontiersin.org/articles/10.3389/fped.2025.1508198/full |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
| _version_ | 1850182934838902784 |
|---|---|
| author | Lei Luo Min Ma Yanzhang Yang Hui Zhao |
| author_facet | Lei Luo Min Ma Yanzhang Yang Hui Zhao |
| author_sort | Lei Luo |
| collection | DOAJ |
| description | Oculocutaneous albinism (OCA) is a condition inherited in an autosomal recessive manner, leading to reduced pigmentation in the skin, hair, and eyes. Oculocutaneous albinism type 2 (OCA2) is one of the most common forms of OCA, caused by OCA2 mutations. This case report presents a newborn with suspected OCA. Postnatal examination revealed white skin, golden-colored hair, and reduced visibility of the retinal pigmented epithelium on fundus photography. Genomic DNA was extracted from the peripheral blood of the patient and her parents. Whole Exome Sequencing (WES) was conducted using chip capture-based high-throughput sequencing technology to analyze genomic DNA from the proband and her parents. Genetic variants of his parents were identified using sanger sequencing. A mutation in the OCA2 was identified: NM_000275.2: c.863_886delTGAGCAGGACCTTTGAGGTGA (p.Met288_Leu295del). Subsequently genetic analyses were conducted. This mutation was recognized as a potential disease-causing mutation, validating diagnosis of OCA2. Currently, few reports have been published regarding this mutation site. It represents a new mutation site in OCA2 (NM_000275.2:c.863_886del), contributing to the genetic diversity of the OCA2. |
| format | Article |
| id | doaj-art-580fe4bef6e240b4ac207c904668b6df |
| institution | OA Journals |
| issn | 2296-2360 |
| language | English |
| publishDate | 2025-04-01 |
| publisher | Frontiers Media S.A. |
| record_format | Article |
| series | Frontiers in Pediatrics |
| spelling | doaj-art-580fe4bef6e240b4ac207c904668b6df2025-08-20T02:17:29ZengFrontiers Media S.A.Frontiers in Pediatrics2296-23602025-04-011310.3389/fped.2025.15081981508198Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2Lei Luo0Min Ma1Yanzhang Yang2Hui Zhao3Department of Pediatrics and Neonatal, Hebei General Hospital, Shijiazhuang, ChinaDepartment of Internal Medicine, The Fourth Hospital of Shijiazhuang (Maternal Hospital Affiliated to Hebei Medical University), Shijiazhuang, ChinaDepartment of Pediatrics and Neonatal, Hebei General Hospital, Shijiazhuang, ChinaDepartment of Pediatrics, The Second Hospital of Hebei Medical University, Shijiazhuang, ChinaOculocutaneous albinism (OCA) is a condition inherited in an autosomal recessive manner, leading to reduced pigmentation in the skin, hair, and eyes. Oculocutaneous albinism type 2 (OCA2) is one of the most common forms of OCA, caused by OCA2 mutations. This case report presents a newborn with suspected OCA. Postnatal examination revealed white skin, golden-colored hair, and reduced visibility of the retinal pigmented epithelium on fundus photography. Genomic DNA was extracted from the peripheral blood of the patient and her parents. Whole Exome Sequencing (WES) was conducted using chip capture-based high-throughput sequencing technology to analyze genomic DNA from the proband and her parents. Genetic variants of his parents were identified using sanger sequencing. A mutation in the OCA2 was identified: NM_000275.2: c.863_886delTGAGCAGGACCTTTGAGGTGA (p.Met288_Leu295del). Subsequently genetic analyses were conducted. This mutation was recognized as a potential disease-causing mutation, validating diagnosis of OCA2. Currently, few reports have been published regarding this mutation site. It represents a new mutation site in OCA2 (NM_000275.2:c.863_886del), contributing to the genetic diversity of the OCA2.https://www.frontiersin.org/articles/10.3389/fped.2025.1508198/fulloculocutaneous albinism type 2OCA2new mutation siteWES (whole exome sequencing)case report |
| spellingShingle | Lei Luo Min Ma Yanzhang Yang Hui Zhao Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2 Frontiers in Pediatrics oculocutaneous albinism type 2 OCA2 new mutation site WES (whole exome sequencing) case report |
| title | Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2 |
| title_full | Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2 |
| title_fullStr | Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2 |
| title_full_unstemmed | Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2 |
| title_short | Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2 |
| title_sort | case report genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the oca2 |
| topic | oculocutaneous albinism type 2 OCA2 new mutation site WES (whole exome sequencing) case report |
| url | https://www.frontiersin.org/articles/10.3389/fped.2025.1508198/full |
| work_keys_str_mv | AT leiluo casereportgeneticanalysisofoculocutaneousalbinismtype2causedbyanewmutationintheoca2 AT minma casereportgeneticanalysisofoculocutaneousalbinismtype2causedbyanewmutationintheoca2 AT yanzhangyang casereportgeneticanalysisofoculocutaneousalbinismtype2causedbyanewmutationintheoca2 AT huizhao casereportgeneticanalysisofoculocutaneousalbinismtype2causedbyanewmutationintheoca2 |