Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2

Oculocutaneous albinism (OCA) is a condition inherited in an autosomal recessive manner, leading to reduced pigmentation in the skin, hair, and eyes. Oculocutaneous albinism type 2 (OCA2) is one of the most common forms of OCA, caused by OCA2 mutations. This case report presents a newborn with suspe...

Full description

Saved in:
Bibliographic Details
Main Authors: Lei Luo, Min Ma, Yanzhang Yang, Hui Zhao
Format: Article
Language:English
Published: Frontiers Media S.A. 2025-04-01
Series:Frontiers in Pediatrics
Subjects:
Online Access:https://www.frontiersin.org/articles/10.3389/fped.2025.1508198/full
Tags: Add Tag
No Tags, Be the first to tag this record!
_version_ 1850182934838902784
author Lei Luo
Min Ma
Yanzhang Yang
Hui Zhao
author_facet Lei Luo
Min Ma
Yanzhang Yang
Hui Zhao
author_sort Lei Luo
collection DOAJ
description Oculocutaneous albinism (OCA) is a condition inherited in an autosomal recessive manner, leading to reduced pigmentation in the skin, hair, and eyes. Oculocutaneous albinism type 2 (OCA2) is one of the most common forms of OCA, caused by OCA2 mutations. This case report presents a newborn with suspected OCA. Postnatal examination revealed white skin, golden-colored hair, and reduced visibility of the retinal pigmented epithelium on fundus photography. Genomic DNA was extracted from the peripheral blood of the patient and her parents. Whole Exome Sequencing (WES) was conducted using chip capture-based high-throughput sequencing technology to analyze genomic DNA from the proband and her parents. Genetic variants of his parents were identified using sanger sequencing. A mutation in the OCA2 was identified: NM_000275.2: c.863_886delTGAGCAGGACCTTTGAGGTGA (p.Met288_Leu295del). Subsequently genetic analyses were conducted. This mutation was recognized as a potential disease-causing mutation, validating diagnosis of OCA2. Currently, few reports have been published regarding this mutation site. It represents a new mutation site in OCA2 (NM_000275.2:c.863_886del), contributing to the genetic diversity of the OCA2.
format Article
id doaj-art-580fe4bef6e240b4ac207c904668b6df
institution OA Journals
issn 2296-2360
language English
publishDate 2025-04-01
publisher Frontiers Media S.A.
record_format Article
series Frontiers in Pediatrics
spelling doaj-art-580fe4bef6e240b4ac207c904668b6df2025-08-20T02:17:29ZengFrontiers Media S.A.Frontiers in Pediatrics2296-23602025-04-011310.3389/fped.2025.15081981508198Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2Lei Luo0Min Ma1Yanzhang Yang2Hui Zhao3Department of Pediatrics and Neonatal, Hebei General Hospital, Shijiazhuang, ChinaDepartment of Internal Medicine, The Fourth Hospital of Shijiazhuang (Maternal Hospital Affiliated to Hebei Medical University), Shijiazhuang, ChinaDepartment of Pediatrics and Neonatal, Hebei General Hospital, Shijiazhuang, ChinaDepartment of Pediatrics, The Second Hospital of Hebei Medical University, Shijiazhuang, ChinaOculocutaneous albinism (OCA) is a condition inherited in an autosomal recessive manner, leading to reduced pigmentation in the skin, hair, and eyes. Oculocutaneous albinism type 2 (OCA2) is one of the most common forms of OCA, caused by OCA2 mutations. This case report presents a newborn with suspected OCA. Postnatal examination revealed white skin, golden-colored hair, and reduced visibility of the retinal pigmented epithelium on fundus photography. Genomic DNA was extracted from the peripheral blood of the patient and her parents. Whole Exome Sequencing (WES) was conducted using chip capture-based high-throughput sequencing technology to analyze genomic DNA from the proband and her parents. Genetic variants of his parents were identified using sanger sequencing. A mutation in the OCA2 was identified: NM_000275.2: c.863_886delTGAGCAGGACCTTTGAGGTGA (p.Met288_Leu295del). Subsequently genetic analyses were conducted. This mutation was recognized as a potential disease-causing mutation, validating diagnosis of OCA2. Currently, few reports have been published regarding this mutation site. It represents a new mutation site in OCA2 (NM_000275.2:c.863_886del), contributing to the genetic diversity of the OCA2.https://www.frontiersin.org/articles/10.3389/fped.2025.1508198/fulloculocutaneous albinism type 2OCA2new mutation siteWES (whole exome sequencing)case report
spellingShingle Lei Luo
Min Ma
Yanzhang Yang
Hui Zhao
Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2
Frontiers in Pediatrics
oculocutaneous albinism type 2
OCA2
new mutation site
WES (whole exome sequencing)
case report
title Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2
title_full Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2
title_fullStr Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2
title_full_unstemmed Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2
title_short Case Report: Genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the OCA2
title_sort case report genetic analysis of oculocutaneous albinism type 2 caused by a new mutation in the oca2
topic oculocutaneous albinism type 2
OCA2
new mutation site
WES (whole exome sequencing)
case report
url https://www.frontiersin.org/articles/10.3389/fped.2025.1508198/full
work_keys_str_mv AT leiluo casereportgeneticanalysisofoculocutaneousalbinismtype2causedbyanewmutationintheoca2
AT minma casereportgeneticanalysisofoculocutaneousalbinismtype2causedbyanewmutationintheoca2
AT yanzhangyang casereportgeneticanalysisofoculocutaneousalbinismtype2causedbyanewmutationintheoca2
AT huizhao casereportgeneticanalysisofoculocutaneousalbinismtype2causedbyanewmutationintheoca2