Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines

The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was asse...

Full description

Saved in:
Bibliographic Details
Main Authors: Zheng-wei ZHOU, Guo-hua CAO, Zhe LI, Xue-jie HAN, Chen LI, Zhen-yu LU, Yu-hang ZHAO, Xue-ling LI
Format: Article
Language:English
Published: KeAi Communications Co., Ltd. 2019-12-01
Series:Journal of Integrative Agriculture
Subjects:
Online Access:http://www.sciencedirect.com/science/article/pii/S2095311919627449
Tags: Add Tag
No Tags, Be the first to tag this record!
_version_ 1849246781268819968
author Zheng-wei ZHOU
Guo-hua CAO
Zhe LI
Xue-jie HAN
Chen LI
Zhen-yu LU
Yu-hang ZHAO
Xue-ling LI
author_facet Zheng-wei ZHOU
Guo-hua CAO
Zhe LI
Xue-jie HAN
Chen LI
Zhen-yu LU
Yu-hang ZHAO
Xue-ling LI
author_sort Zheng-wei ZHOU
collection DOAJ
description The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.
format Article
id doaj-art-3daee7875c6843b3a8fb42ad00e78e5f
institution Kabale University
issn 2095-3119
language English
publishDate 2019-12-01
publisher KeAi Communications Co., Ltd.
record_format Article
series Journal of Integrative Agriculture
spelling doaj-art-3daee7875c6843b3a8fb42ad00e78e5f2025-08-20T03:58:23ZengKeAi Communications Co., Ltd.Journal of Integrative Agriculture2095-31192019-12-0118122835284310.1016/S2095-3119(19)62744-9Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovinesZheng-wei ZHOU0Guo-hua CAO1Zhe LI2Xue-jie HAN3Chen LI4Zhen-yu LU5Yu-hang ZHAO6Xue-ling LI7State Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaState Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaState Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaState Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaState Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaState Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaState Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaCorrespondence LI Xue-ling, Tel: +86-471-3679807; State Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaThe CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.http://www.sciencedirect.com/science/article/pii/S2095311919627449CRISPR/Cas9gRNAtargeting siteoff-target rate
spellingShingle Zheng-wei ZHOU
Guo-hua CAO
Zhe LI
Xue-jie HAN
Chen LI
Zhen-yu LU
Yu-hang ZHAO
Xue-ling LI
Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines
Journal of Integrative Agriculture
CRISPR/Cas9
gRNA
targeting site
off-target rate
title Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines
title_full Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines
title_fullStr Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines
title_full_unstemmed Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines
title_short Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines
title_sort truncated grna reduces crispr cas9 mediated off target rate for mstn gene knockout in bovines
topic CRISPR/Cas9
gRNA
targeting site
off-target rate
url http://www.sciencedirect.com/science/article/pii/S2095311919627449
work_keys_str_mv AT zhengweizhou truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines
AT guohuacao truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines
AT zheli truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines
AT xuejiehan truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines
AT chenli truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines
AT zhenyulu truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines
AT yuhangzhao truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines
AT xuelingli truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines