Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines
The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was asse...
Saved in:
| Main Authors: | , , , , , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
KeAi Communications Co., Ltd.
2019-12-01
|
| Series: | Journal of Integrative Agriculture |
| Subjects: | |
| Online Access: | http://www.sciencedirect.com/science/article/pii/S2095311919627449 |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
| _version_ | 1849246781268819968 |
|---|---|
| author | Zheng-wei ZHOU Guo-hua CAO Zhe LI Xue-jie HAN Chen LI Zhen-yu LU Yu-hang ZHAO Xue-ling LI |
| author_facet | Zheng-wei ZHOU Guo-hua CAO Zhe LI Xue-jie HAN Chen LI Zhen-yu LU Yu-hang ZHAO Xue-ling LI |
| author_sort | Zheng-wei ZHOU |
| collection | DOAJ |
| description | The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology. |
| format | Article |
| id | doaj-art-3daee7875c6843b3a8fb42ad00e78e5f |
| institution | Kabale University |
| issn | 2095-3119 |
| language | English |
| publishDate | 2019-12-01 |
| publisher | KeAi Communications Co., Ltd. |
| record_format | Article |
| series | Journal of Integrative Agriculture |
| spelling | doaj-art-3daee7875c6843b3a8fb42ad00e78e5f2025-08-20T03:58:23ZengKeAi Communications Co., Ltd.Journal of Integrative Agriculture2095-31192019-12-0118122835284310.1016/S2095-3119(19)62744-9Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovinesZheng-wei ZHOU0Guo-hua CAO1Zhe LI2Xue-jie HAN3Chen LI4Zhen-yu LU5Yu-hang ZHAO6Xue-ling LI7State Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaState Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaState Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaState Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaState Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaState Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaState Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaCorrespondence LI Xue-ling, Tel: +86-471-3679807; State Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.ChinaThe CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.http://www.sciencedirect.com/science/article/pii/S2095311919627449CRISPR/Cas9gRNAtargeting siteoff-target rate |
| spellingShingle | Zheng-wei ZHOU Guo-hua CAO Zhe LI Xue-jie HAN Chen LI Zhen-yu LU Yu-hang ZHAO Xue-ling LI Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines Journal of Integrative Agriculture CRISPR/Cas9 gRNA targeting site off-target rate |
| title | Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines |
| title_full | Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines |
| title_fullStr | Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines |
| title_full_unstemmed | Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines |
| title_short | Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines |
| title_sort | truncated grna reduces crispr cas9 mediated off target rate for mstn gene knockout in bovines |
| topic | CRISPR/Cas9 gRNA targeting site off-target rate |
| url | http://www.sciencedirect.com/science/article/pii/S2095311919627449 |
| work_keys_str_mv | AT zhengweizhou truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines AT guohuacao truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines AT zheli truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines AT xuejiehan truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines AT chenli truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines AT zhenyulu truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines AT yuhangzhao truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines AT xuelingli truncatedgrnareducescrisprcas9mediatedofftargetrateformstngeneknockoutinbovines |